بررسی مقاومت افزایش یافته به آنتی بیوتیک‌های گروه آمینوگلیکوزیدی (HLAR) در انتروکوکوس فکالیس با …

۳-۱۰-روش اﻧﺠﺎم آزﻣﺎﯾﺶ:

ﯾﮏ ﺳﻮآب اﺳﺘﺮﯾﻞ ﺑﻪ ﺳﻮﺳﭙﺎﻧﺴﯿﻮن ﻣﯿﮑﺮوﺑﯽ آﻏﺸﺘﻪ ﺷﺪه (اﺿﺎﻓﻪ ﺳﻮﺳﭙﺎﻧﺴﯿﻮن ﺑﺎ ﻓﺸﺎردادن ﺳﻮاب ﺑﻪ ﺑﺪﻧﻪ داﺧﻠﯽ ﻟﻮﻟﻪ ﺧﺎرج ﻣﯽ ﺷﺪ) ﺳﭙﺲ ﺗﻤﺎﻣﯽ ﺳﻄﺢ ﯾﮏ پلیت ﻣﺤﯿﻂ ﮐﺸﺖ ﻣﻮﻟﺮ ﻫﯿﻨﺘﻮن آﮔﺎر ﮐﻪ یک ساعت قبل در دمای اتاق قرار داده شده است، ﺗﻮﺳﻂ ﺳﻮآب آﻏﺸﺘﻪ ﺑﻪ ﻧﻤﻮﻧﻪ ﻣﯿﮑﺮوﺑﯽ و ﺑﺎ ﺣﺮﮐﺖ و ﻣﺎﻟﺶ ﺳﻮآب در ﺗﻤﺎﻣﯽ ﺳﻄﺢ ﻣﺤﯿﻂ و ﺑﺎ زاوﯾﻪ ۶۰ درﺟﻪ، ﺗﻠﻘﯿﺢ ﻣﯽ ﺷﺪ (کشت خطی). ۳ ﺗﺎ ۵ دﻗﯿﻘﻪ از ﺗﻠﻘﯿﺢ ﻣﺤﯿﻂ ﮐﺸﺖ ﺑﺎ ﺳﻮﺳﭙﺎﻧﺴﯿﻮن ﺑﺎﮐﺘﺮﯾﺎﯾﯽ، دﯾﺴﮏ ﻫﺎی اﺳﺘﺎﻧﺪارد آﻣﺎده آﻧﺘﯽ ﺑﯿﻮﺗﯿﮏ را در ﺳﻄﺢ ﻣﺤﯿﻂ ﻗﺮار داده می شوند. ﭘﻠﯿﺖ ﻫﺎ ﺑﻪ ﻣﺪت ۲۴ ﺳﺎﻋﺖ در درﺟﻪ C0 ۳۷-۳۵ در اﻧﮑﻮﺑﺎﺗﻮر ﻗﺮار ﮔﺮﻓﺘﻨﺪ (۱۷۱). ﺳﭙﺲ ﻗﻄﺮ ﻧﺎﺣﯿﻪ ﻋﺪم رﺷﺪ در اﻃﺮاف دﯾﺴﮏﻫﺎی آﻧﺘﯽ ﺑﯿﻮﺗﯿﮑﯽ ﺑﻮﺳﯿﻠﻪ ﺧﻂ ﮐﺶ اﻧﺪازه ﮔﯿﺮی ﺷﺪه و ﺑﺎ اﺳﺘﻔﺎده از ﺟﺪول اﺳﺘﺎﻧﺪارد.  ﺣﺴﺎﺳﯿﺖ و ﻣﻘﺎوﻣﺖ انتروکوکهاﺗﻌﯿﯿﻦ ﮔﺮدﯾﺪ.

۳-۱۱-بررسی مقاومت افزایش یافته به جنتامایسین و استرپتومایسین

باکتریهای مشکوک به HLAR[62] با روش غربالگری دیسک دیفیوژن جدا سازی شدند. در این روش ابتدا یک کشت تازه با غلظت معادل نیم مک فارلند تهیه شده و با سواب استریل بر روی محیط کشت مولر هینتون آگار کشت خطی داده شد. سپس دیسک های جنتامایسین ( ۱۲۰ میکروگرم) و استرپتومایسین (۳۰۰ میکروگرم) بر روی محیط کشت آگار قرار داده شد. پلیت ها در C0 ۳۷ و به مدت ۲۴ ساعت گرم خانه گزاری شدند. سپس قطر منطقه عدم رشد با خط کش اندازه گیری شد. مقاومت با مشاهده رشد کامل باکتری دراطراف دیسک گزارش شده و حساسیت بامنطقه ممانعت ازرشد بیشتر از ۱۰ میلی متر گزارش شد. مناطق ممانعت از رشدبین ۷ تا ۹ میلی متر نیز به عنوان حدواسط در نظر گرفته شدند. از E. fecalis ATCC 29212 به عنوان شاهد حساس و از E. fecalis ATCC 51299 به عنوان شاهد مقاوم به عنوان کنترل استفاده شد.
۳-۱۲-آماده سازی و انجام واکنش زنجیره پلی مراز

۳-۱۲-۱-اﺳﺘﺨﺮاج DNA

اﺳﺎس اﺳﺘﺨﺮاج ژﻧﻮم از ﺗﻤﺎم ﻧﻤﻮﻧﻪ ﻫﺎی ﺣﺎوی DNAﯾﮑﺴﺎن می‌باشد وﻟﯿﮑﻦ ﺑﺎ ﺗﻮﺟﻪ به اینکه چه کاربردی از DNA حاصله ﻣﺪ ﻧﻈﺮ اﺳﺖ ﻣﯽ ﺗﻮان از اﻧﻮاع روشهای ﻣﺨﺘﻠﻒ اﺳﺘﻔﺎده کرد. اﯾﻦ ﻣﺮاﺣﻞ به طور کلی ﺷﺎﻣﻞ ﻣﻮراد زﯾﺮ می‌باشد:
آﻣﺎده ﺳﺎزی ﻧﻤﻮﻧﻪ ها
از ﺑﯿﻦ ﺑﺮدن دﯾﻮاره ﺳﻠﻮﻟﯽ ﯾﺎ ﻟﯿﺰ ﮐﺮدن ﺳﻠﻮﻟﻬﺎ
ﺟﺪاﮐﺮدن ﻣﻮاد ﻏﯿﺮ از DNA
ﺧﺎﻟﺺ ﺳﺎزی DNAاز ﻧﺎﺧﺎﻟﺼﯽ ﻫﺎ
ﺗﻐﻠﯿﻆ DNA

۳-۱۲-۲-استخراج از باکتری کشت داده شده :

برای این منظور با آزمایش مستقیم از نمونه محیط کشت بلادآگار دارای کلنی تک، خلوص کشت تائید شد سپس بوسیله فیلدوپلاتین تعداد هشت کلنی یک شکل‌ و یک اندازه در زیر هود بیولوژیک کلاسII و مجاورت شعله (شرایط استریل) برداشته شد و در ۳۰۰ ماکرولیتر آب مقطر دو بار تقطیر در زیر هود بیولوژیک سوسپانسیون تهیه گردید. سپس تیوپ محتوی نمونه به مدت ۳۰ دقیقه در ماکروفر با دمای ۱۰۰ سلسیوس قرار گرفت. پس از آن تیوپ ورتکس شد. در مرحله بعد مقدار µl250 آب مقطر دوبار تقطیر به مخلوط افزوده شد و تیوپ به بن ماری ۵۵ – ۵۶ درجه سلسیوس بمدت ۱۵ دقیقه منتقل گردید و ورتکس میکروتیوپ انجام شد. تیوپ محتوی مخلوط بمدت یک دقیقه و دمای ۱۹ درجه سلسیوس و دورrpm 7000 سانتریفیوژ شد. پس از بیرون آوردن از دستگاه سانتریفوژ دو فاز (رسوب DNA و مایع روئی شفاف) تشکیل شد، که غلظت DNA در مرحله بعد تعیین گردید.

برای دانلود فایل متن کامل پایان نامه به سایت ۴۰y.ir مراجعه نمایید.

۳-۱۲-۳-اندازه‌گیری غلظت DNA ژنومیک تخلیص شده

با این روش می‌توان غلظت نمونه DNA را به کمک جذب نوری آن در طول موج nm 260 و با استفاده از رابطه زیر به دست آورد. بدین منظور از دستگاه اسپکتروفوتومتر استفاده شد. چنانچه در مراحل استخراج DNA، از RNase برای از بین بردن RNA استفاده شده باشد، جذب نوری در nm 260، فقط میزان DNA را نشان خواهد داد. در این طول موج یک واحد جذب، معادل ۵۰ میکروگرم DNA در هر میلی لیتر است. جذب نوری در طول موج nm 280 نیز وجود پروتئین در نمونه را اثبات می‌کند. جذب اشعه ماوراء بنفش برای بررسی خلوص DNA حاصل هم استفاده می شود. به این صورت که با بررسی نسبت جذب نوری نمونه در nm 260 به جذب آن در nm 280 می‌توان خلوص DNA استخراج شده را تعیین کرد. چنانچه عدد بدست آمده از این نسبت بین ۲-۵/۱ باشد، DNA خالص، و اگر کمتر از ۵/۱ باشد، نمایانگر آلودگی نمونه استخراج شده با پروتئین خواهد بود. اعداد بالاتر از ۲ نشانگر آلودگی با فنل یا RNA هستند.
نکته: جذب نوری در طول موج nm 230، شاخص آلودگی نمونه با اوره و یا اجزاء آروماتیک پروتئینها می‌باشد. اساس UV اسپکتروفتومتری می تواند به طور اتوماتیک غلظت DNA را با استفاده از جذب نوری در طول موج nm 260، محاسبه کند. به این صورت که پس از آماده سازی نمونه و قرار دادن آن در مکان قرارگیری نمونه، دستگاه غلظت نمونه مورد نظر را در طول موج مربوطه محاسبه می نماید.

۳-۱۲-۴-انتخاب و تهیه پرایمر‌های مناسب

برای این منظور کلیه مقالات قابل دسترسی مربوط به تشخیص انتروکوکوس فکالیس بروش مولکولی (PCR) مطالعه شد. با بررسی و انتخاب پرایمرهای مورد نظر جفت پرایمرهای ارائه شده در مقاله رفرانس، جهت تعیین میزان همولوژی ناحیه انتخاب شده با ژنوم سایرگونه های مختلف باکتریائی و هم چنین ژنوم جنس و گونه های مختلف انتروکوکس از سایت اینترنتی بنام www.ncbi.nlm.nih.gov و Blast استفاده و تعیین ترادف نوکلئوتیدی انجام گردید. هم چنین جهت ارزیابی خصوصیات پرایمرها از نظر لوپ و…. از برنامه نرم‌افزارهای مولکولی Oligo و Gene runner استفاده گردید. سرانجام جهت سنتز توالی نوکلئوتیدی پرایمر به شرکت تحقیقاتی سیناکلون سفارش ساخت داده شد.
جدول ‏۰‑۱: پرایمرهای استفاده شده در این مطالعه برای پیدا کردن سویه‌های مقاوم به آمینوگلیکوزید

توالی مورد نظر ژن مقاومت
CAGGAATTTATCGAAAATGGTAGAAAAG
CACAATCGACTAAAGAGTACCAATC
aac(6’)-Ie -aph(2’’)-Ia
CTTGGACGCTGAGATATATGAGCAC
GTTTGTAGCAATTCAGAAACACCCTT
aph(2’’)-Ib
CCACAATGATAATGACTCAGTTCCC
CCACAGCTTCCGATAGCAAGAG